View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_166 (Length: 239)
Name: NF6076_high_166
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_166 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 6803040 - 6802813
Alignment:
| Q |
1 |
tacagttctattaggttagatgtatccgaaattagttgttcattaaaggtgggcgttgggattatggaatgctatgaattggcttcttagctcggggg-t |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6803040 |
tacagttctattaggttagatgtatccgaaattagttgttcattaa-ggtgagcgttgggattatggaatgctatgaattggcttcttagctcggggggt |
6802942 |
T |
 |
| Q |
100 |
cacacaacgtgacatttgaacatgattgatgcagtcaattctagagaaatatgtttgattggttttgtcattgtttcggtatgtctgccttcaagctata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6802941 |
cacacaacgtgacatttgaacatgattgatgcagtcaattctagagaaatatgtttgattggttttgtcattgtttcggtatgtctgccttcaagctata |
6802842 |
T |
 |
| Q |
200 |
tgataggtccaagatgacctatgtgatga |
228 |
Q |
| |
|
|||||| |||||||||||| |||| |||| |
|
|
| T |
6802841 |
tgatagatccaagatgacccatgttatga |
6802813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 4796374 - 4796294
Alignment:
| Q |
1 |
tacagttctattaggttagatgtatccgaaattagttgttcattaaaggtgggcgttgggattatggaatgctatgaattgg |
82 |
Q |
| |
|
||||| ||||| |||||||||| ||||| ||||||||||| ||| | |||| |||||||| |||||||||||| | |||||| |
|
|
| T |
4796374 |
tacagctctatcaggttagatgcatccggaattagttgtttatt-acggtgagcgttggggttatggaatgctttcaattgg |
4796294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University