View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_169 (Length: 238)
Name: NF6076_high_169
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_169 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5806931 - 5806707
Alignment:
| Q |
1 |
ccaagcttcaaggtttggagtccagtgcgcaaccttgatgaagatgctattgttgcggaactaatagataccgatttaaagcaatggaagagagctcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5806931 |
ccaagcttcaaggtttggagtccagtgcgcaaccttgatgaagatgttgttgttgcggaactaatagatactgatttaaagcaatggaagagagctcttg |
5806832 |
T |
|
| Q |
101 |
ttctagacagtttcaatgagtttgaggccaa----ccagagccttaatattcccctctcttggcgcttacccgaggataagaaggtgtggaattgagaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5806831 |
ttctagacagtttcaatgagtttgaggccaaccggccagagccttaatatttccctctcttggcgcttacccgaggataagaaggtgtggaattgagaaa |
5806732 |
T |
|
| Q |
197 |
gaaacagttactactcagtcagatc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5806731 |
gaaacagttactactcagtcagatc |
5806707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University