View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_174 (Length: 237)
Name: NF6076_high_174
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_174 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 100 - 237
Target Start/End: Original strand, 5655873 - 5656010
Alignment:
| Q |
100 |
tttgaagtatcttcaatgagtagttttgtcttctccccttctcttcttcctaccaactcataatctccattccaagaagaatacagtatagtgatttcaa |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5655873 |
tttgaactatcttcaatgagtagttttgtcttctccccttctcttcttcctaccaactcataatctccattccaagaagaatacagtatagtgatttcaa |
5655972 |
T |
|
| Q |
200 |
aataagcttcttgtggaaatgcatggttccccaaaaaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5655973 |
aataagcttcttgtggaaatgcatggttccccaaaaaa |
5656010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 5655774 - 5655808
Alignment:
| Q |
1 |
cctccacctgttaaccccaatgaaaacatcacaga |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5655774 |
cctccacctgttaaccccaatgaaaacatcacaga |
5655808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University