View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_181 (Length: 230)
Name: NF6076_high_181
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_181 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 65 - 225
Target Start/End: Original strand, 2625128 - 2625286
Alignment:
| Q |
65 |
gcatgtccttcatgagcaggtcggagactccattttaacnnnnnnnnnngtgggaatatcggacagagactcttacaaactgactcgcccagttggatag |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
2625128 |
gcatgtccttcatgagcaggtcggagactccattttagcaaaaaaaa--gtgggaatatcggacagagactcttacaaaccgactcacccagttggatag |
2625225 |
T |
 |
| Q |
165 |
aggggaccgaatctgccttttccgggaacttcttgcattgcgcgaagaatatccacaaaac |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625226 |
aggggaccgaatctgccttttccgggaacttcttgcattgcgcgaagaatatccacaaaac |
2625286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 2624977 - 2625038
Alignment:
| Q |
1 |
gaaaatcacgattaggagcataagaggtggacatttgccaaaccatgtatgagcactaccat |
62 |
Q |
| |
|
|||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2624977 |
gaaaatcacggttaggagcgtaagaggtgcacatttgccaaaccatgtatgagcactaccat |
2625038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University