View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_188 (Length: 226)
Name: NF6076_high_188
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_188 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 2677294 - 2677519
Alignment:
| Q |
1 |
aacctttctctttataatattattaggacataaaaactgcaactgcaattttgttccaatcaaaatgaaagtgctaattgttatttttgtttatgtttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2677294 |
aacctttctctttataatattattaggacataaaaactgcaactgcaattttgttccaatcaaaatgaaagtgctaattgttatttttgtttatgtttgt |
2677393 |
T |
 |
| Q |
101 |
ctatcaatgcttgataaagtatcttatgcagctgataccttgactcaaaattcttcaattgtagatggtcaagaacttatttcagctggacaaatttttt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2677394 |
ctatcaatgcttgataaagcatcttatgcagctgataccttgactcaaaattcttcaattatagatggccaagaacttatttcagctggacaaatttttt |
2677493 |
T |
 |
| Q |
201 |
gtcttggtttcttcagcccaggaagc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2677494 |
gtcttggtttcttcagcccaggaagc |
2677519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University