View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_204 (Length: 211)
Name: NF6076_high_204
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_204 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 40729948 - 40729774
Alignment:
| Q |
15 |
cagagacaagtttatctcgatataatttggttcgtgctaaaattgtgaaagaacaannnnnnnngttctaatcatccggttcttagataatgaatgtgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| || |||||||| |
|
|
| T |
40729948 |
cagagacaagtttatctcgatataatttggttcgtgctaaaattgtgaaagaacaattttttttgttctaatcatccgattctta----atcaatgtgat |
40729853 |
T |
 |
| Q |
115 |
tgtaaaaattcaaagttcgatcgaaaaataaataaaatttggctaaatattatttctacccaaaatcgaatttaggttt |
193 |
Q |
| |
|
|||||||||||| |||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40729852 |
tgtaaaaattcagagttcgatcgaaaagtatataaaatttggttaaatattatttctacccaaaatcgaatttaggttt |
40729774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University