View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_207 (Length: 208)
Name: NF6076_high_207
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_207 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 33545481 - 33545292
Alignment:
| Q |
17 |
agaatttagaccgcttaaatacaaaaaattaaaatttggttaaaagagagaacacacgatatgtaaatttcgtgtcaataacatgccgtaac---nnnnn |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
33545481 |
agaatttagaccgcttaaatacaaaaaattaaaatttggttaaaggagagaacacacgatatgtaaatttcatgtcaataacatgtcgtaacaaaaaaaa |
33545382 |
T |
 |
| Q |
114 |
nnnnttctctctttcgaataccatttttcatccaaaggccttaaacatgatagtc--ctttaagagatacaacgagttcatctcactcga |
201 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| || ||||| |
|
|
| T |
33545381 |
aaaattctctctttcgaacatcatttttcatccaaaggccttaaacatgataatccactttaagagatacgacgagttcatttctctcga |
33545292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University