View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_46 (Length: 405)
Name: NF6076_high_46
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 64 - 386
Target Start/End: Complemental strand, 14225635 - 14225312
Alignment:
| Q |
64 |
tacttgattacaagtttgaattttggtatgcaatgctcttgaaaatccaaatcttatgatacgtatcaggttatgataaaaaa-taaaccagcacagtca |
162 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
14225635 |
tacttgattacaaatttgaattttggtatgcaatgctcttgaaattccaaatcttatgatacttatcaggttatcataaaaaaataaaccagcacggtca |
14225536 |
T |
|
| Q |
163 |
aacagctcgaatagtgagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgcttg |
262 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14225535 |
aacagctcgaatggtgagaggtttaagagtgatgtggtggtcgtgctagagataactcggcaaacagctgacccttcatctaatccttcacctttgcttg |
14225436 |
T |
|
| Q |
263 |
gaccatctttactctcccatccttcaccatttcctgaaccatctttgttatcccatccttcaactttgcctggaatgtcgtttttatcctatccttcatc |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14225435 |
gaccatctttactctcccatccttcaccatttcctgaaccatctttgttatcccatccttcaactttgcatggaatgtcgtttttatcctatccttcatc |
14225336 |
T |
|
| Q |
363 |
ttttctatctcatcgttcaccttt |
386 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14225335 |
ttttctatctcatcgttcaccttt |
14225312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University