View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_50 (Length: 399)
Name: NF6076_high_50
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 107 - 341
Target Start/End: Complemental strand, 10911464 - 10911243
Alignment:
| Q |
107 |
ctcaactacttccttttttgggtagttcctatgtacttactttacttgtgatgattccttgatgcatgagaatttggttttcgcttcctacgtggcaggg |
206 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10911464 |
ctcaactacttccttttttgg-tagttcctatgtactt---------gtgatgattcgttgatgcatgagaatttggttttcgcttcctacgtggcaggg |
10911375 |
T |
 |
| Q |
207 |
tattttggtagtttcataaaccatttttcagtcctttcgctctctgcaacattccccttctctcgccgtcgtcaaacacccgtcctaacgacgacgactc |
306 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| | |
|
|
| T |
10911374 |
tattttggtagtttcataaaccttttttcagtcctttcgctctctgcaacattccccttctctcgccgtcgtcaaacagccgtcctaacga---cgacac |
10911278 |
T |
 |
| Q |
307 |
tgtggttgacggagaaataatatgaaggaggtgag |
341 |
Q |
| |
|
|||| |||||||||||||||||||| || |||||| |
|
|
| T |
10911277 |
tgtgcttgacggagaaataatatgacggtggtgag |
10911243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 11 - 84
Target Start/End: Complemental strand, 10911553 - 10911483
Alignment:
| Q |
11 |
ggagcagagatgttgaacgttgaagggttgttgttgttgctttcagtattgatcttagaattgccatggttgct |
84 |
Q |
| |
|
|||| ||||||| |||||| ||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10911553 |
ggagaagagatgatgaacgatgaagggtttttgttg---ctttcagcattgatcttagaattgccatggttgct |
10911483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 13724641 - 13724706
Alignment:
| Q |
18 |
agatgttgaacgttgaagggttgttgttgttgctttcagtattgatcttagaattgccatggttgc |
83 |
Q |
| |
|
||||| |||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13724641 |
agatgatgaacgatgaagggttgtttttgttgctttcgttattgatcttagaattgccatggttgc |
13724706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University