View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_81 (Length: 335)
Name: NF6076_high_81
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_81 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 35808713 - 35808393
Alignment:
| Q |
1 |
agacactgtctatggatgcataggtgctatagcacgtttgcaaaggaagatggttgaacttcaacatgatcttgccattgcaaaggatcgtctggctcgt |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35808713 |
agaccctgtctatggatgcataggtgctatagcacttttgcaaaggaagatggttgaacttcaacatgatcttgccattgcaaaggatcgcctggctcgt |
35808614 |
T |
 |
| Q |
101 |
tgcgctgcggctgctgctactcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808613 |
tgcgctgcggctgctgctactcctacttcttctttttccaatgatatgatgaattcaaatgttagtttgccaccttttcctgagtttttcacttgcagtg |
35808514 |
T |
 |
| Q |
201 |
acttcagtgataatttaagtcacagttcttcgtctcaatcgtttactcgaaatgaaactgtcgatgatttcgttcaaattccttatatattttaatgctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808513 |
acttcagtgataatttaagtcacagttcttcgtctcaatcgtttactcgaaatgaaactgtcgatgatttcgttcaaattccttatatattttaatgctg |
35808414 |
T |
 |
| Q |
301 |
ttatcaccccctttcccttat |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35808413 |
ttatcaccccctttcccttat |
35808393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 38 - 102
Target Start/End: Complemental strand, 32036309 - 32036245
Alignment:
| Q |
38 |
ttgcaaaggaagatggttgaacttcaacatgatcttgccattgcaaaggatcgtctggctcgttg |
102 |
Q |
| |
|
||||||||||||||| | |||||||| |||||| | |||||||| ||||| ||||| |||||||| |
|
|
| T |
32036309 |
ttgcaaaggaagatgatggaacttcagcatgatttggccattgctaaggaacgtcttgctcgttg |
32036245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University