View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_85 (Length: 331)
Name: NF6076_high_85
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 148 - 313
Target Start/End: Complemental strand, 35676216 - 35676051
Alignment:
| Q |
148 |
aaccacttgaatagagtagtataaataattgataatattattccttaaaagagataattgaatgaagatggtaaatggaaacaaatgaatgataattatt |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35676216 |
aaccacttgaatagaggagtataaataattgataatattattccttaaaagagataattgaatgaagatggtaaatggaaacaaatgaatgacaattatt |
35676117 |
T |
 |
| Q |
248 |
tgaatgaagacgggtaggatgaataattgataatattccatgaaaagagataattaaagccattgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35676116 |
tgaatgaagacgggtaggatgaataattgataatattccatgaaaagagataattaaagccattgc |
35676051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University