View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_high_92 (Length: 316)
Name: NF6076_high_92
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_high_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 59 - 300
Target Start/End: Complemental strand, 12691080 - 12690839
Alignment:
| Q |
59 |
ttcacaatgtcaaagccatgtgagacatcatcaccgttgtcatctgatagcatctcagtttcccgtattcaatgtggtattggacatcatcgacattgtt |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12691080 |
ttcacaatgtcaaagccatgtgagacatcatcaccgttgtcatctgatagcatctcagtttcccgtattcaatgtggtattggacatcatcgacattgtt |
12690981 |
T |
 |
| Q |
159 |
gattttggagatgaacgaggtgagttgcctcgggtggaaaatccttgtataatactcttatacaccgagagaaaataaagttgcgataacgacctcacct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12690980 |
gattttggagatgaacgaggtgagttgcctcgggtggaaaatccttgtataatactcttatacaccgagagaaaataaagttgcgataacgacctcacct |
12690881 |
T |
 |
| Q |
259 |
tcgtcgaggagttacatgtttgagttcattggtaatgattat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12690880 |
tcgtcgaggagttacatgtttgagttcattggtaatgattat |
12690839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University