View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_134 (Length: 254)
Name: NF6076_low_134
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_134 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 42250123 - 42249875
Alignment:
| Q |
1 |
gtgtatgtatgtattcatcttcaatcacacatacataaatacatacatacacgcataatctttcaacccttcttatatatcttccttcgcatttt----- |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
42250123 |
gtgtatgtatgtattcatcttcaatcacacatacataaatacatacatacacgcataatctttcaacccttcttatatatctttctccgcattttttttg |
42250024 |
T |
 |
| Q |
96 |
------ccttcacc-tttgcgtttcgattcaattcaatttttgataatcatgaacggtttagtcaacaacggtaacggtggcgtcaaagctgttcttcat |
188 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42250023 |
ttgaatccttagctatttgcgtttcgattcaattcaatttttgataatcatgaacggtttagtcaacaacggtaacggtggcgtcaaagctgttcttgat |
42249924 |
T |
 |
| Q |
189 |
aaggcggagaagcttattattgatactgaccctgggatcggtttgtttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42249923 |
aaggcggagaagcttattattgatactgaccctgggatcggtttgtttc |
42249875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 110
Target Start/End: Complemental strand, 42250152 - 42250124
Alignment:
| Q |
82 |
ttccttcgcattttccttcacctttgcgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42250152 |
ttccttcgcattttccttcacctttgcgt |
42250124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University