View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_135 (Length: 253)
Name: NF6076_low_135
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_135 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 25 - 243
Target Start/End: Original strand, 44515685 - 44515906
Alignment:
| Q |
25 |
ggaagacaaggtaaacc-ttaaatataacttttaatttatgtctttaattggtgtctgaattcgagggctgtctaggcgatatgaa--cttgaattttca |
121 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
44515685 |
ggaagacaaggtaaaccattaaatataacttttaatttatgtctttaattggtgtctgaatccgagggttgtctaggtgatatgaagacttgaattttca |
44515784 |
T |
|
| Q |
122 |
gtgatgttgtcttggtgattctgatctgtttctgtttgagcagaattataggtgtccgtctcttgtttgtgtttactttattttggaggatcttcggatt |
221 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44515785 |
gtgatgttgtcttagtgattctgatccgtttctgtttgagcagaattataggcgtctgtctcttgtttgtgtttactttattttgggggatcttcggatt |
44515884 |
T |
|
| Q |
222 |
ttgttttcatgaggtacctttg |
243 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
44515885 |
ttgttttcatgaggcacctttg |
44515906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 71 - 228
Target Start/End: Original strand, 1917411 - 1917570
Alignment:
| Q |
71 |
attggtgtctgaattcgagggc-tgtctaggcgatatgaa--cttgaattttcagtgatgttgtcttggtgattctgatctgtttctgtttgagcagaat |
167 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |||||| |||||| ||||||||||||| |||||||| | ||||| |||| |||| |
|
|
| T |
1917411 |
attggtgtctgaatccgagggcatgtctaggcgatatgaagacttgaactttcagcattgttgtcttggtgtttctgatccttgtctgtatgagtagaag |
1917510 |
T |
|
| Q |
168 |
tataggtgtccgtctcttgtttgtgtttactttattttggaggatcttcggattttgtttt |
228 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||| ||||| ||||||| |||||||||||| |
|
|
| T |
1917511 |
tacaggtgtccgtctcttgtttgtgtttgctttagtttgg-ggatctttggattttgtttt |
1917570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 73 - 228
Target Start/End: Complemental strand, 29121146 - 29120988
Alignment:
| Q |
73 |
tggtgtctgaattcgagggc-tgtctaggcgatatgaa--cttgaattttcagtgatgttgtcttggtgattctgatctgtttctgtttgagcagaatta |
169 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||||| ||||||||||||| ||||||||||||| |||||||| | ||||||||||||||| || |
|
|
| T |
29121146 |
tggtgtttgaatccgagggcgtgtctaggcgatatgaagacttgaattttcagcattgttgtcttggtgtttctgatccttgtctgtttgagcagaagta |
29121047 |
T |
|
| Q |
170 |
taggtgtccgtctcttgtttgtgtttactttattttggaggatcttcggattttgtttt |
228 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||| ||| ||||||| | |||||||||| |
|
|
| T |
29121046 |
caggtgtccttcttttgtttgtgtttgctttagtttaagggatctttgaattttgtttt |
29120988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University