View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_136 (Length: 251)
Name: NF6076_low_136
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_136 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 38973746 - 38973511
Alignment:
| Q |
16 |
aacaactgagttaatacgtctatgaaaactttaaactcagagtacatgaacatcaaactcataaaactattcatgatgttcattaaaagaaagaaagtta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38973746 |
aacaactgagttaatacgtctatgaaaactttaaactcagagtacatgaacatcaaactcataaaactattcatgatgttcattaaaagaaagaaagtta |
38973647 |
T |
 |
| Q |
116 |
ttcatgtttgtcttctttcattgagtaacttcaattggttagttgaagttaatgagaagagtcttaactttcttctacacactttccctttctcccgtgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38973646 |
ttcatgtttgtcttctttcattgagtaacttcaattggttagttgaagttaatgagaagagtcttaactttcttctacacactttccctttctcccgtgg |
38973547 |
T |
 |
| Q |
216 |
ttgctattaattcctttagttgaccaaaaaatattt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38973546 |
ttgctattaattcctttagttgaccaaaaaatattt |
38973511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University