View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_160 (Length: 242)
Name: NF6076_low_160
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_160 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 15687624 - 15687401
Alignment:
| Q |
18 |
gtttttactttaaaatgtcatatttcattggtcatgtatacattaatagattcaattcacgtttcataaaatagatcttccagattcacaatttgaatat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15687624 |
gtttttactttaaaatgtcatatttcattggtcatgtatacattaatagattcaattcacgtttcggaaaatagatcttccagattcacaatttgaatat |
15687525 |
T |
 |
| Q |
118 |
cgact--------------atggttgtcaagtacaccattagaatatattacaacatgaaattaggagtacccttgtttcagagctatttatatgatgat |
203 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15687524 |
cgacttgataatgacaaccatggttgtcaagtacaccattagaatatattacaacatgaaattaggagtacctttgtttcagagctatttatatgatgat |
15687425 |
T |
 |
| Q |
204 |
gttaaatctgttttatgttctctg |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
15687424 |
gttaaatctgttttatgttctctg |
15687401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University