View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_183 (Length: 232)
Name: NF6076_low_183
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_183 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 19 - 214
Target Start/End: Original strand, 49168998 - 49169210
Alignment:
| Q |
19 |
agaagtcaagagagaatatactctttaattctcaaattagaaactcacaattttaca---------atgatcttacatgaaaggaatgaccttatttata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
49168998 |
agaagtcaagagagaatatactctttaattctcaaattagaaactcacaattttagataaactttaatgatcttacatgaaaggaatgaccttatttata |
49169097 |
T |
|
| Q |
110 |
ctaatcttagaggcaaaattacatatgaaatagtagtagtaatcaatacatcaatggaaaca--------taaaatttggaaatgtcaaacatagtagct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
49169098 |
ctaatcttagaggcaaaattacatatgaaatagtagtagtaatcaatacatcaatggaaacacagtctggtaaaatttggaaatgtcaaagatagtagct |
49169197 |
T |
|
| Q |
202 |
tagagtcaataat |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49169198 |
tagagtcaataat |
49169210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University