View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_196 (Length: 223)
Name: NF6076_low_196
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_196 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 22 - 190
Target Start/End: Original strand, 40572178 - 40572346
Alignment:
| Q |
22 |
aaagacaatcattgtacgtggtgcatattagaaaactagaattgtaaaaataggttggattgaaggagtttgtgtatgggaaagacaaaatatggatatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40572178 |
aaagacaatcattgtacgtggtgcatattagaaagctagaattttaaaaataggttggattgaaggagtttgtgtatgggaaagacaaaatatggatatt |
40572277 |
T |
|
| Q |
122 |
ggagaattggcaaatggaaaaggggaacaaccaaaaagaaaccaccgtacatgaattcggtttataagt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40572278 |
ggagaattggcaaatggaaaaggggaacaaccaaaaagaaaccaccgtacatgaattcggtttataagt |
40572346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University