View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_209 (Length: 211)
Name: NF6076_low_209
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_209 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 54733075 - 54733285
Alignment:
| Q |
1 |
gatgcatggtgaaattctctgaaaaagagagtataaagagtgaagatgataacaaaatgaagttggaagagaaacaggagataaaaacagagatgggttt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733075 |
gatgcatggtgaaattctctcaaaaagagagtataaagagtgaagatgataacaaaatgaagttggaagagaaacaggagataaaaacagagatgggttt |
54733174 |
T |
|
| Q |
101 |
ggaagtgaagggatataggaggtgtcaatcggaaattgagttggtgaggggtgtgaatagtgatgatgcgaaggatcaaagagtgttgcaaaggtgtgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733175 |
ggaagtgaagggatataggaggtgtcaatcggaaattgagttggtgaggggtgtgaatagtgatgatgcgaaggatcaaagagtgttgcaaaggtgtgag |
54733274 |
T |
|
| Q |
201 |
agtgataatga |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
54733275 |
agtgataatga |
54733285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University