View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_212 (Length: 207)
Name: NF6076_low_212
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_212 |
 |  |
|
| [»] scaffold0425 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0425 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: scaffold0425
Description:
Target: scaffold0425; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 4444 - 4253
Alignment:
| Q |
1 |
tcttttgattaatatcatttcctccttctctcttttgatcattcatcgctcctcaccaacctcctcctagctagatgctttgcaacacaacttctgtgcc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444 |
tcttttgattaatatcatttccttcttctctcttttgatcattcatcgctcctcaccaacctcctcctagctagatgctttgcaacacaacttctgtgcc |
4345 |
T |
 |
| Q |
101 |
gcactgttgttcctgcacattcacgaccacggcaacaaatctgtctttgctagatccaccctctcccgacgccaaattaaatctaagaaatt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4344 |
gcactgttgttcctgcacattcacgaccacggcaacaaatctgtctttgctagatccaccctctcccgacgccaaattaaatctaagaaatt |
4253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 6852581 - 6852446
Alignment:
| Q |
1 |
tcttttgattaatatcatttcctccttctctcttttgatcattcatcgctcctcaccaacctcctcctagctagatgctttgcaacacaacttctgtgcc |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6852581 |
tcttttgattaatatcatttccttcttctctcttttgatcattcatcgctcctcaccaacctcctcctagctagatgctttgcaacacaacttttgtgcc |
6852482 |
T |
 |
| Q |
101 |
gcactgttgttcctgcacattcacgaccacggcaac |
136 |
Q |
| |
|
|| || |||||||||||||||||||||| |||||| |
|
|
| T |
6852481 |
acagtgctgttcctgcacattcacgaccatggcaac |
6852446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 325558 - 325520
Alignment:
| Q |
1 |
tcttttgattaatatcatttcctccttctctcttttgat |
39 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
325558 |
tcttttgattaatatcatttccttcttctctcttttgat |
325520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University