View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_79 (Length: 343)
Name: NF6076_low_79
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 55034536 - 55034873
Alignment:
| Q |
1 |
attctctagcccgctcgctttacaatctgtaattctcttgcccgctcaccctgtctgcttttacaatcaacaattgcagtaccctgctggaacaccagag |
100 |
Q |
| |
|
||||||| |||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55034536 |
attctcttgcccgctcactttacaatctttaattctcttgcccgctcaccctttctgcttttacaatcaacaattgcagtaccctgctggaacaccagag |
55034635 |
T |
|
| Q |
101 |
gtggctcttacagcatcagatagtgcagggatcgccgtgttaacatcacctatgaatgcacaagttggctataagcgcagtgcattcattggaagttgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55034636 |
gtggctcttacagcatcagatagtgcagggatcgccgtgttaacatcacctatgaatgcacaagttggctataagcgcagtgcattcattggaagttgta |
55034735 |
T |
|
| Q |
201 |
agcatcaagtgtggcaggctatcagagcatcgtctgctgctccatattatcttgatgatttttctgatggtactaatggctctgctgttgtttgcatgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55034736 |
agcatcaagtgtggcaggctatcagagcatcgtctgctgctccatattatcttgatgatttttctgatggtactaatggctctgctgttgtttgcatgaa |
55034835 |
T |
|
| Q |
301 |
gttgcctgtttttaagatttgctatttcctcttctgtg |
338 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55034836 |
gttgcctgtttttaagatttgttatttcctcttctgtg |
55034873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University