View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_88 (Length: 326)
Name: NF6076_low_88
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_88 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 38794230 - 38793921
Alignment:
| Q |
1 |
tgttttcgagtcttgaaaagatgtgtgtgctgctggtctatgatatatatcaccctaatctggactctggagatactgtaaagtgggatgcataaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38794230 |
tgttttcgagtcttgaaaagatgtgtatgctgctggtctatgatatatatcaccctaatctggactctggagataccgtaaagtgggatgcataaacaaa |
38794131 |
T |
|
| Q |
101 |
tcatgcttaattaaagaaatataaatggacttaccataaatttttgttcttgtttagtctgaactctgaacgttctgtaccagtaagcgggattgagtcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38794130 |
tcatgcttaattaaagaaatataaatggacttaccataaatttttgttcttgtttagtctgaactctgaacgttctgtaccagtaagcgggattgagtcc |
38794031 |
T |
|
| Q |
201 |
tctaatggttaccttttggtatcgcataaatcaatcaatgttgatgctcatcgtcatattttaccaattcatcacgacctttcttaacgcctgcagccaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38794030 |
tctaatggttaccttttggtatcgcataaatcaatcaatgttgatgctcatcgtcatattttaccaattcatcacgacctttcttaacgcctgcagccaa |
38793931 |
T |
|
| Q |
301 |
gccactccca |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
38793930 |
gccactccca |
38793921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 195 - 244
Target Start/End: Original strand, 52471850 - 52471899
Alignment:
| Q |
195 |
gagtcctctaatggttaccttttggtatcgcataaatcaatcaatgttga |
244 |
Q |
| |
|
||||| ||||| ||||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
52471850 |
gagtcttctaaaggttaccttttggtatcccataaattaaacaatgttga |
52471899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University