View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6076_low_97 (Length: 308)
Name: NF6076_low_97
Description: NF6076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6076_low_97 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 6e-77; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 34590921 - 34590700
Alignment:
| Q |
1 |
ttgtagtgtcataatcatccagatatgcagggcttctgcttagccttttccccaaatcctaattttcatcattgctattttcagaatcagatactacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
34590921 |
ttgtagtgtcataatcatccagatatgcagggcttctgcttagccttttccccaaatcctaattttcatcattgctattttcagaatcagatgctataac |
34590822 |
T |
 |
| Q |
101 |
attttttgctcatcaatttcaggttgcctttca---------------------tcattttcactatgattgcttgcgttgtaggttaccttgtttgtgt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34590821 |
attttttgctcatcaatttcaggttgcctttcattatttacttcaggctcattttcattttcactatgattgcttgcgttgtaggttaccttgtttgtgt |
34590722 |
T |
 |
| Q |
180 |
tgctcatttcattattagtgac |
201 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34590721 |
tgctcatttcattattagtgac |
34590700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 258 - 308
Target Start/End: Complemental strand, 34590059 - 34590009
Alignment:
| Q |
258 |
tactttgtaactcgtcaattgtcatcgtagttgcatcattcaattcttcta |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34590059 |
tactttgtaactcgtcaattgtcatcgtagttgcatcattcaattcttcta |
34590009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 230 - 263
Target Start/End: Complemental strand, 34590701 - 34590668
Alignment:
| Q |
230 |
acccattgttttgattattcaacttgtatacttt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
34590701 |
acccattgttttgattattcaacttgtatgcttt |
34590668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University