View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6078_high_16 (Length: 240)
Name: NF6078_high_16
Description: NF6078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6078_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 27321742 - 27321888
Alignment:
| Q |
1 |
ttaatcatatcatgttgccaaagaacaagggtcgaagttggtgaaccataaagagttaacactcaagttagtttttgtgtgatatgggtgagaggtcgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27321742 |
ttaatcatatcatgttgccaaagaacaagggtcgaagttggtgaaccataaaaagttaacactcaagttagtttttgtgtgatatgggtgagag---gtt |
27321838 |
T |
 |
| Q |
101 |
taaaataataaaatgtttgtctctctccttgtgtagatatgattttacag |
150 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27321839 |
taacataatgaaatgtttgtctctctccttgtgtagatatgatttcacag |
27321888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University