View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6078_low_11 (Length: 278)
Name: NF6078_low_11
Description: NF6078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6078_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 164 - 264
Target Start/End: Complemental strand, 35907163 - 35907063
Alignment:
| Q |
164 |
tgaaatgtactatagtacctcacagtcagttaaataaattacagtaaaatgtaaaaattgcaaaccatgtgaaagtttgttgttcgtttcatggttgacc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35907163 |
tgaaatgtactatagtacctcacagtcagttaaataaattacagtaaaatgtaaaaattgcaaaccatgtgaaagtttgttgttcgtttcatggttgacc |
35907064 |
T |
 |
| Q |
264 |
t |
264 |
Q |
| |
|
| |
|
|
| T |
35907063 |
t |
35907063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 4 - 140
Target Start/End: Complemental strand, 35907485 - 35907348
Alignment:
| Q |
4 |
atgtccaagaatataagcacattttaagaaaaacatgtcttaaaatannnnnnncttcaaattattagatatatttatccnnnnnnn-aatcatatgtac |
102 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35907485 |
atgtcctaaaatataagcacattttaagaaaaacatgtcttaaaatatttttttcttcaaattattagatatatttatctttttttttaatcatatgtac |
35907386 |
T |
 |
| Q |
103 |
tatcaaataatgtgacaaagggttttagaagataaaaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35907385 |
tatcaaataatgtgacaaagggttttagaagataaaaa |
35907348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University