View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6078_low_15 (Length: 243)

Name: NF6078_low_15
Description: NF6078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6078_low_15
NF6078_low_15
[»] chr1 (1 HSPs)
chr1 (1-234)||(46791032-46791265)


Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 46791265 - 46791032
Alignment:
1 tttataaatatcattgcaaattgcaaaagcattcattgtgatgtgacaagttgacttgtgaattaggttggattggatcttccccctcccttgaaaatca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46791265 tttataaatatcattgcaaattgcaaaagcattcattgtgatgtgacaagttgacttgtgaattaggttggattggatcttccccctcccttgaaaatca 46791166  T
101 ataaagggaaatgcatccatccaagttccaactgctctcaattggatgcctagtttgtaaattatctcaccgttgcggcaaccctacaatcaatttcatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46791165 ataaagggaaatgcatccatccaagttccaactgctctcaattggatgcctagtttgtaaattatctcaccgttgcggcaaccctacaatcaatttcatt 46791066  T
201 attccaatcttgcgtttccttatttattatacct 234  Q
    ||||||||||||||||||||||||||||||||||    
46791065 attccaatcttgcgtttccttatttattatacct 46791032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University