View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6078_low_19 (Length: 218)
Name: NF6078_low_19
Description: NF6078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6078_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 97 - 203
Target Start/End: Original strand, 32536448 - 32536553
Alignment:
| Q |
97 |
taacgaccagaataagaacaacaaccatgttctccgatctcgttttatttggtttgaaagtgcgacggccagaacaaaggaggtgaggtggtcggcgatg |
196 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32536448 |
taacgaccagaataagaacaacgac-atgttcttcgatctcgttttatttggtttgaaagtgcgacggccagaacaaaggaggtgaggtggtcagcgatg |
32536546 |
T |
 |
| Q |
197 |
ttctctg |
203 |
Q |
| |
|
||||||| |
|
|
| T |
32536547 |
ttctctg |
32536553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University