View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6079_low_14 (Length: 358)
Name: NF6079_low_14
Description: NF6079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6079_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 9 - 106
Target Start/End: Complemental strand, 50909382 - 50909285
Alignment:
| Q |
9 |
gcaagcagttgactagtttttactaattctcttacctgatctgttgtgttgttgctgaaggaagaaacttattttggaccttttactgtgcaaattat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50909382 |
gcaagcagttgactagtttttactaattctcttacctgatctgttgtgttgttgctgaaggaagaaacttattttggaccttttactgtgcaaattat |
50909285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 105 - 196
Target Start/End: Complemental strand, 50908938 - 50908846
Alignment:
| Q |
105 |
atcttccctt-ctaattgatctggacatggggcggtttatcaatgtttatctcttgagcaatagtagcacaactggatggttcttcaccattt |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50908938 |
atcttccctttctaattgatctggacatggggcggtttatcaatgtttatctcttgagcaatagtagcacaactggatggttcttcaccattt |
50908846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 344
Target Start/End: Original strand, 50996701 - 50996765
Alignment:
| Q |
280 |
acaggctgccaaagataagagggcaagagacaggtcaactaattgcgattgagaaggttagttat |
344 |
Q |
| |
|
||||||||||||||||| | ||||||||||| || ||||| ||| |||||||||||| ||||| |
|
|
| T |
50996701 |
acaggctgccaaagatacaatggcaagagacaagttaactatatgctattgagaaggtttgttat |
50996765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University