View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6080_low_3 (Length: 369)
Name: NF6080_low_3
Description: NF6080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6080_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 19 - 170
Target Start/End: Original strand, 25190270 - 25190421
Alignment:
| Q |
19 |
atatgaccgcctgcaccgttagttacaccgtggcacatgttacaccttttgccataccgattgggtctgcgcccagctcgaaacagtttacatataaaac |
118 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25190270 |
atatgaccgcctgcagcattagttacaccgtggcacatgttacaccttttgccataccgattgggtctgcgcccagctcgaaacagtttacatataaaac |
25190369 |
T |
 |
| Q |
119 |
gattaacatgaggagcaactttaaattttgaaatcaagaactatggtctata |
170 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25190370 |
cattaacatgaggaggaactttaaattttgaaatcaagaactatggtctata |
25190421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 223 - 309
Target Start/End: Original strand, 25190421 - 25190507
Alignment:
| Q |
223 |
aaccaacttgactgtaaaactaacgaactgaagttagcctccaaatcaacttgtctcatgaattgttggtataagagaagtattaac |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25190421 |
aaccaacttgactgtaaaactaacgaactgaagttagcctccaaatcaacttgtctcatgaattgttggtataagagaagtattaac |
25190507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University