View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6080_low_4 (Length: 332)
Name: NF6080_low_4
Description: NF6080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6080_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 114 - 322
Target Start/End: Original strand, 26621385 - 26621593
Alignment:
| Q |
114 |
gaagtgtaaattttcttcactttttagtatttatatatgagctttatattgaggagtttttgtttaattggagctgtttcttaattattagactaatcat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26621385 |
gaagtgtaaattttcttcactttttagtatttatatatgagctttatattgaggagtttttgtttaattggagctgtttcttaattattagactaatcat |
26621484 |
T |
 |
| Q |
214 |
gtgttaatttggggggagggtaagaaattattagagcttatatataacaattattgaggttaaataatatttgtgtactttgattacatggtttctcctt |
313 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26621485 |
gtgttaatctgtggggagggtaagaaattattagagcttatatataacaattattgaggttaaattatatttgtgtactttgattacatggtttctcctt |
26621584 |
T |
 |
| Q |
314 |
tgtcctttg |
322 |
Q |
| |
|
||||||||| |
|
|
| T |
26621585 |
tgtcctttg |
26621593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University