View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6082_high_13 (Length: 401)
Name: NF6082_high_13
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6082_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Original strand, 3989980 - 3990372
Alignment:
| Q |
1 |
tctttttgtgtggctagttgtttagatgaagagtatagtctcaagatttatttctatattccttttccccaggagcggaaagagtacttaccttcaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3989980 |
tctttttgtgtggctagttgtttagatgaagagtatagtctcaagatttatttctatattccttttccccaggagcggaaagagtacttaccttcaacaa |
3990079 |
T |
 |
| Q |
101 |
gtgtgtctcatagttatcattgctcaagttgggtgttacgttcctgcccgcttctcaactcttagggtagttgaccgtgttttcacaaggatgggtgcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990080 |
gtgtgtctcatagttatcattgctcaagttgggtgttacgttcctgcccgcttctcaactcttagggtagttgaccgtgttttcacaaggatgggtgcag |
3990179 |
T |
 |
| Q |
201 |
ttgataatcttgaatcaaactctagcacggtacaatttcttgatgcctgtgttttgaagctatttgattatgttcatatgtttataattatatatgaagt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3990180 |
ttgataatcttgaatcaaactctagcacggtacaatttcttgatgcctgtgttttgaagctatttgattctgttcatatgtttataattatatatgaagt |
3990279 |
T |
 |
| Q |
301 |
tatctggaagtgtagttcatgacagagatgaaagagacagcttttatcatgcagaatgtttcagagaggtaacaccaccttttgatattcttc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3990280 |
tatctggaagtgtagttcatgacagagatgaaagagacagcttttatcatgcagaatgtttcagagaggtaacaccaccttttgattttcttc |
3990372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University