View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6082_high_43 (Length: 241)
Name: NF6082_high_43
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6082_high_43 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 106 - 241
Target Start/End: Original strand, 45855852 - 45855986
Alignment:
| Q |
106 |
aagtctaatttgcggcggatagtagtagtgggtattggaaacttaattatgcagtaaacccagaaacagtctttgttttgtagtccttaatagtgccttt |
205 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45855852 |
aagtctaatttgcgg-ggatagtagtagtgggtattggaaacttaattatgcagtaaacccagaaacagtctttgttttgtagtccttaaaagtgccttt |
45855950 |
T |
 |
| Q |
206 |
tcttttcacatacacatgcacaaatcaaatagaatt |
241 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45855951 |
tcttttcacataaacatgcacaaatcaaatagaatt |
45855986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 241
Target Start/End: Original strand, 41254729 - 41254812
Alignment:
| Q |
160 |
taaacccagaaacagtctttgttttgtagtccttaatagtgcct--tttcttttcacatacacatgcacaaatcaaatagaatt |
241 |
Q |
| |
|
||||||||||| |||| |||||||| ||||||||| ||||| | ||| ||| |||||| |||||||||||| ||||||||| |
|
|
| T |
41254729 |
taaacccagaagcagtttttgtttttaagtccttaaaagtgctttgtttttttacacataaacatgcacaaattgaatagaatt |
41254812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University