View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6082_low_24 (Length: 304)
Name: NF6082_low_24
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6082_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 9933167 - 9932874
Alignment:
| Q |
1 |
gttacatttttctttacaatttttatctctcactagttatcatagaaagctttaaagggagaaataaatggcagattgggctccaattgttataggcttg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9933167 |
gttacatttttctttataatttttatctctcactagttatcatagaaagcttcaaagggagaaataaatggcagattgggctccaattgttataggcttg |
9933068 |
T |
|
| Q |
101 |
atcttgtttgtgttattttcacctggattactatttcagctacctggcaaaggcagggtggtggaatttgtcaatttccaaacaagtgccatttccattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9933067 |
atcttgtttgtgttattttcacctggattactatttcagctacctggcaaaggcagggtggtggaatttgttaatttccaaacaagtgccatttccattt |
9932968 |
T |
|
| Q |
201 |
ttgttcattctcttctcttctttggctttatggttatctttcttgttgccattaatgttcatatcaatagtggttaagtgatcatccacctatg |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9932967 |
ttgttcattcccttctcttctttggctttatggttatctttcttgttgccattaatgttcatatcaatagtggttaagtgatcatccacctatg |
9932874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 9938132 - 9937847
Alignment:
| Q |
1 |
gttacatttttctttacaatttttatctctcact---agttatcatagaaagctttaaagggagaaataaatggcagattgggctccaattgttataggc |
97 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| ||||||| ||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9938132 |
gttacatttttctttaccatttttatctctcactgctagttaacatagaacgctccaataggagaaataaatggcagattgggctccaattgttataggc |
9938033 |
T |
|
| Q |
98 |
ttgatcttgtttgtgttattttcacctggattactatttcagctacctggcaaaggcagggtggtggaatttgtcaatttccaaacaagtgccatttcca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9938032 |
ttgatcttgtttgtgttattttcacctggattactatttcagctaccaggcaaaggcagggtggtggaatttgtcaatttccaaacaagtgctatttcca |
9937933 |
T |
|
| Q |
198 |
tttttgttcattctcttctcttctttggctttatggttatctttcttgttgccattaatgttcatatcaatagtggttaagtgatc |
283 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
9937932 |
tttttgttcattcccttctcttctttggatttatggttatctttattgttgccattgatgttcatatctacagtggttaagtgatc |
9937847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University