View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6082_low_25 (Length: 293)
Name: NF6082_low_25
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6082_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 12 - 278
Target Start/End: Complemental strand, 51314262 - 51313996
Alignment:
| Q |
12 |
atgaaatgaacaaaccattttaagtccttgatcagcaccattacttgagacagagagttggttttgaagcttggtcgatgagaagattttgttggacaag |
111 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51314262 |
atgaaatgaacaaaccattttaagttcttgatcagcaccattacttgagacagagagttggttttgaagcttggtggatgagaagattttgttggacaag |
51314163 |
T |
 |
| Q |
112 |
tgatttctagttggcttagataaatcaatcaacaagccacaaatgaaaccaataacaagacctggaatgaaattctctggcttgaaacttcctgataacc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51314162 |
tgatttctagttggcttagataaatcaatcaacaagccacaaatgaaaccaataacaagacctggaatgaaattctctggcttgaaacttcctgataacc |
51314063 |
T |
 |
| Q |
212 |
attcccccttttgcttttgttgctgtttctgcaaattctcaaatcaaataccattcaataaaataat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51314062 |
attcccccttttgcttttgttgctgtttctgcaaattctcaaatcaaataccattcaataaaataat |
51313996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University