View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6082_low_31 (Length: 251)
Name: NF6082_low_31
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6082_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 46686109 - 46685884
Alignment:
| Q |
10 |
aaaatctgacaagaggaatgctttcaatgaaaagcctgtgcttcctagaaaacacactagtgatccacaaaggtgtattttgcaaggaaatggttcttgc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46686109 |
aaaatctgacaagaggaatgctttcaatgaaaagcccgtgcttcctagaaaacacactagtgatccacaaaggtgtattttgcaaggaaatggttcttgc |
46686010 |
T |
|
| Q |
110 |
ttaaatcattacaatggcaaagaaaacgataatatgtcttctgaaagaaaaactgaatcgcagagctcctcttctttgcatctctctgcaaggcaagggc |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46686009 |
ttaaatcattacaacggcaaagaaaacgaaaatatgtcttctgaaagaaaaactgaatcgcagagctcctcttctttgcatctctctgcaaggcaagggc |
46685910 |
T |
|
| Q |
210 |
attgcctatcactggtcccttcacaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46685909 |
attgcctatcactggtcccttcacaa |
46685884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University