View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6082_low_40 (Length: 244)
Name: NF6082_low_40
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6082_low_40 |
 | |
|
| [»] scaffold1717 (1 HSPs) |
| | |
|
| [»] scaffold1527 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 37757499 - 37757269
Alignment:
| Q |
1 |
ttatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757499 |
ttatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgt |
37757400 |
T |
|
| Q |
101 |
agttgtaaggtatccggaggagagtaatggcggcggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaagaacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757399 |
agttgtaaggtatccggaggagagtaatggcggtggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaagaacat |
37757300 |
T |
|
| Q |
201 |
gaagatgagtatcatgatgctgatgatgatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37757299 |
gaagatgagtatcatgatgctgatgatgatg |
37757269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1717 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold1717
Description:
Target: scaffold1717; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 106
Target Start/End: Complemental strand, 460 - 397
Alignment:
| Q |
43 |
atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt |
106 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
460 |
atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt |
397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1527 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold1527
Description:
Target: scaffold1527; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 106
Target Start/End: Complemental strand, 706 - 643
Alignment:
| Q |
43 |
atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt |
106 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
706 |
atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt |
643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University