View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6082_low_43 (Length: 241)

Name: NF6082_low_43
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6082_low_43
NF6082_low_43
[»] chr4 (2 HSPs)
chr4 (106-241)||(45855852-45855986)
chr4 (160-241)||(41254729-41254812)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 106 - 241
Target Start/End: Original strand, 45855852 - 45855986
Alignment:
106 aagtctaatttgcggcggatagtagtagtgggtattggaaacttaattatgcagtaaacccagaaacagtctttgttttgtagtccttaatagtgccttt 205  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
45855852 aagtctaatttgcgg-ggatagtagtagtgggtattggaaacttaattatgcagtaaacccagaaacagtctttgttttgtagtccttaaaagtgccttt 45855950  T
206 tcttttcacatacacatgcacaaatcaaatagaatt 241  Q
    |||||||||||| |||||||||||||||||||||||    
45855951 tcttttcacataaacatgcacaaatcaaatagaatt 45855986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 241
Target Start/End: Original strand, 41254729 - 41254812
Alignment:
160 taaacccagaaacagtctttgttttgtagtccttaatagtgcct--tttcttttcacatacacatgcacaaatcaaatagaatt 241  Q
    ||||||||||| |||| ||||||||  ||||||||| ||||| |  ||| ||| |||||| ||||||||||||  |||||||||    
41254729 taaacccagaagcagtttttgtttttaagtccttaaaagtgctttgtttttttacacataaacatgcacaaattgaatagaatt 41254812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University