View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6082_low_52 (Length: 213)
Name: NF6082_low_52
Description: NF6082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6082_low_52 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 3725186 - 3724992
Alignment:
| Q |
19 |
tgctattataatctgaaatcgaaactaatttccctccgatttcttctgtatctattacattgatatctcaaaagagttaaaatttataatacgtgtaatg |
118 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3725186 |
tgctattataatttgaaatcgaaactagtttccctctgatttcttctatatctattacattgatatctcaaaagagttaaaatttataatacgtttaatg |
3725087 |
T |
 |
| Q |
119 |
ttaaccttaaattctgaatcaggatgtggtcgatgtctgaatatagagaaatttcaaggacctttagtgatatgaacccactaaaattaaactca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||| |||||||||||||| |
|
|
| T |
3725086 |
ttaaccttaaattctgaatcaggatgtggtcgatgtctgaatatagagaaatttcaaggacctttagagagatgaaaccaataaaattaaactca |
3724992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University