View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6083_high_11 (Length: 236)
Name: NF6083_high_11
Description: NF6083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6083_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 228
Target Start/End: Original strand, 38569577 - 38569789
Alignment:
| Q |
16 |
aaaacaccagctcctcatctgttctgtgacaacatcagagcacctacttatgctctaatctagtttttcactctcaaatgaagcatatcacacttgacta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
38569577 |
aaaacaccagctcctcatctgttctgtgacaacatcagagcacctacttatgctctaatccagtttttcactctcgaatgaagcatatcgcacttgacta |
38569676 |
T |
 |
| Q |
116 |
ccattatgtacgtcaacttgttcaattgggtcaactctgtatgtctcacatttctaccaaagatcaacctgcagacattctcataaagtctttgtccaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569677 |
ccattatgtacgtcaacttgttcaattgggtcaactctgtatgtctcacatttctaccaaagatcaacctgcagacattctcataaagtctttgtccaaa |
38569776 |
T |
 |
| Q |
216 |
cccaggttcattt |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38569777 |
cccaggttcattt |
38569789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University