View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6083_low_11 (Length: 239)
Name: NF6083_low_11
Description: NF6083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6083_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 53699454 - 53699675
Alignment:
| Q |
1 |
cacttagagaaataattacttcaaatggagaactgaaaa-aatgacttttaaaggcgcaacgtacttgattttgcatttggtgtatgtgttaccattgtt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53699454 |
cacttagagaaataattacttcaaatggagaactgaaaaaaatgacttttaaaggcgcaacgtacttgattttgcatttggtgtatgtgttaccattgtt |
53699553 |
T |
 |
| Q |
100 |
aatttgttatgaagcagaaaattacgtgttccccacttaaaaaacacaaaatggaaagctatatgcctatatctattatagtgctgttgatattacttac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53699554 |
aatttgttatgaagcagaaaattacgtgttccccacttaaaaaacacaaaatggaaagctatatgcctatatctattatagtgctgttgattttacttac |
53699653 |
T |
 |
| Q |
200 |
attactttttccactataacta |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53699654 |
attactttttccactataacta |
53699675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University