View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6083_low_5 (Length: 325)
Name: NF6083_low_5
Description: NF6083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6083_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 18 - 101
Target Start/End: Complemental strand, 39498999 - 39498916
Alignment:
| Q |
18 |
ttcaagaccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggtatga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39498999 |
ttcaagaccaagtctcatgaaccatgctgctggttcctcaattgtgttccctatttatggcaatgtttatcctgttgggtatga |
39498916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 263 - 322
Target Start/End: Complemental strand, 39498762 - 39498703
Alignment:
| Q |
263 |
gaaagatgtgagtatccaaattcatacctttgtttatcaattattaggcccttctgtgtt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
39498762 |
gaaagatgtgagtatccaaattcatacctttgtttaacaattattaggcccttttgtgtt |
39498703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University