View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6083_low_6 (Length: 322)
Name: NF6083_low_6
Description: NF6083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6083_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 269; Significance: 1e-150; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 2 - 310
Target Start/End: Original strand, 34872182 - 34872490
Alignment:
| Q |
2 |
cacacataattgaaaattttaggagaagaactcatgatgcatatgtagacactttgaataacctttagtcattgcagttttaccccggccagcggttccc |
101 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
34872182 |
cacacataattgaaaattttaggaaaagaactcatgatgcatatgtagacactttgaataaccttcagtcattgcagttttgctccggccagcggttccc |
34872281 |
T |
 |
| Q |
102 |
aggtcttgaataaccttcagctttagatcactgcggcaaatggtcgagtgggggccatatcgatcaggatcggaccgcacgttcaacagctggagcagat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| || |
|
|
| T |
34872282 |
aggtcttgaataaccttcagctttagatcactgcggcaaatggtcgagtgggggccatatcgatcaggatcggaccacacgttcaacagttggagcaaat |
34872381 |
T |
 |
| Q |
202 |
cctctccctcagaccgaagaggcacaactttgacgggcacattcttccctttgtcaacaggctccaccctattccccttgagagagttgctcgcctctac |
301 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34872382 |
cctctccctgagactgaagaggcacaactttgacgggcacattcttccctttgtcaacaggctccaccctattccccttgagagagttgctcacctctac |
34872481 |
T |
 |
| Q |
302 |
ctccatatt |
310 |
Q |
| |
|
||||||||| |
|
|
| T |
34872482 |
ctccatatt |
34872490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 34875017 - 34874981
Alignment:
| Q |
9 |
aattgaaaattttaggagaagaactcatgatgcatat |
45 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34875017 |
aattgaaaattttaggaaaagaactcatgatgcatat |
34874981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 2 - 53
Target Start/End: Complemental strand, 34873442 - 34873391
Alignment:
| Q |
2 |
cacacataattgaaaattttaggagaagaactcatgatgcatatgtagacac |
53 |
Q |
| |
|
||||||||||| ||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
34873442 |
cacacataattaaaaattttaataaaagaactcgtgatgcatatgtagacac |
34873391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University