View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6084_high_8 (Length: 269)
Name: NF6084_high_8
Description: NF6084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6084_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 5 - 263
Target Start/End: Complemental strand, 6140904 - 6140646
Alignment:
| Q |
5 |
catctcttaaatttagcacaacagtagtctgattgctttatttcttgttttcaaaacatgacgttcataattgaaatcgacatgatttgtgtaaaggaac |
104 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6140904 |
catctcttaaatttaccacaacagtagtctgattgctttatttcttgttttcaaaacatgacgttcataattgaaatcgacatgatttgtgtaaaggaac |
6140805 |
T |
|
| Q |
105 |
aacaatcaaactttcctttgtctataaaattgttcttttttgcttgtaaccaattgtggacctacatgcattttaatttgggtctacaaatacaccctag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6140804 |
aacaatcaaactttcctttgtctataaaattgttcttttttgcttgtaaccaattgtggacctacatgcattttaatttgggtctacaaatacaccctag |
6140705 |
T |
|
| Q |
205 |
attttgataaaattataagtaatatattgattttgtgtggttttctccctttatgtttc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6140704 |
attttgataaaattataagtaatatattgattttgtgtggttttctccctttatgtttc |
6140646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University