View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6084_low_4 (Length: 377)
Name: NF6084_low_4
Description: NF6084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6084_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 167 - 369
Target Start/End: Original strand, 37100765 - 37100967
Alignment:
| Q |
167 |
aacatcaacaacacaagcaagcataacagttacaatagtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100765 |
aacatcaacaacacaagcaagcataacagttacagtagtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagat |
37100864 |
T |
|
| Q |
267 |
aaagagttaacgtgtgtctctgcaacttaactcagagttttccttcccaatgaaatgaaaatgaatctcactgcccttcttggtctacgcaattactgat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37100865 |
aaagagttaacgtgtgtctctgcaacttaactcagagttttccttcccaatgaaatgaaaatgaatctcactgcccttcttggtctacgcaattactgct |
37100964 |
T |
|
| Q |
367 |
gat |
369 |
Q |
| |
|
||| |
|
|
| T |
37100965 |
gat |
37100967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 12 - 145
Target Start/End: Original strand, 37100604 - 37100741
Alignment:
| Q |
12 |
atagggatttttggggttcttggaaagtataataatct----gtaaaaggtggaatcagattcatcttatgcaaaatgagtagtagtgtagtctttcttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100604 |
atagggatttttggggttcttggaaagtataataatctatctgtaaaaggtggaatcagattcatcttatgcaaaatgagtagtagtgtagtctttcttt |
37100703 |
T |
|
| Q |
108 |
catctttctgttgtgtacatcaaacaaatcaaatagtt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100704 |
catctttctgttgtgtacatcaaacaaatcaaatagtt |
37100741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University