View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6085_high_6 (Length: 252)
Name: NF6085_high_6
Description: NF6085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6085_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 4896052 - 4896292
Alignment:
| Q |
1 |
tagcaaatgataatccaacaatggagagacccaagcacaaaatgggagaagccatgttctgatggaattctgatgaagttgttgaatttggaagttctga |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4896052 |
tagcaaatgataatctaacaatggagagacccaagcacaaaatgggagaagccatgttttgatggaattctgatgaagttgttgaatttggaagttctga |
4896151 |
T |
|
| Q |
101 |
aacgtctttcaactatagtagcttgctgcaaacatgcttcttcaatcataacagcttttcgcaaacactttgcatcctgtaacaaatcagcttaatcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4896152 |
aacgtctttcaactatagtagcttgctgcaaacatgcttcttcaatcaaaacagcttttcgcaaacactttgcatcctgtaacaaatcagcttaatcaca |
4896251 |
T |
|
| Q |
201 |
aacctcaacacatttccttccattccccttcctggtttcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4896252 |
aacctcaacacatttccttccattccccttcctggtttcat |
4896292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 10885410 - 10885268
Alignment:
| Q |
1 |
tagcaaatgataatccaacaatggagagacccaagcacaaaatgggagaagccatgttctgatggaattctgatgaagttgttgaatttggaagttctga |
100 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||| || ||||||| |
|
|
| T |
10885410 |
tagcaaatgataatccagcaatgtagagacccaagcacaaagtgggagaagccatgttctgatggatatctgatgaagttattgaattttgaggttctga |
10885311 |
T |
|
| Q |
101 |
aacgtctttcaactatagtagcttgctgcaaacatgcttcttc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
10885310 |
aacgtctttcaactatagtagcttgctgcaaccgtgcttcttc |
10885268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 194
Target Start/End: Complemental strand, 39203195 - 39203151
Alignment:
| Q |
150 |
aacagcttttcgcaaacactttgcatcctgtaacaaatcagctta |
194 |
Q |
| |
|
|||||||||||| |||||| ||||||| ||||||||||| ||||| |
|
|
| T |
39203195 |
aacagcttttcgtaaacacgttgcatcatgtaacaaatcggctta |
39203151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University