View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_high_20 (Length: 243)
Name: NF6086_high_20
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 64 - 227
Target Start/End: Original strand, 3261312 - 3261474
Alignment:
| Q |
64 |
gatgtgttcaaattatattgtcaaaagagaaatactaggacacactatgcaatagtcattcttttattgacaacaatcggatctattttaacgtacggta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
3261312 |
gatgtgttcaaattatattgtcaaaagagaaatactaggacacactatgcaacaatcgttcttttatcgacaacaattaaatctattttaacgtaaggta |
3261411 |
T |
 |
| Q |
164 |
ctaacattaattttaactaatnnnnnnnntagatgttaaaaatagaatgtttttggcacttttt |
227 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3261412 |
ctaacattaatattaactaat-aaaaaaatagatgttaaaaatagaatgtttttggcacttttt |
3261474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University