View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_high_23 (Length: 237)
Name: NF6086_high_23
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_high_23 |
 |  |
|
| [»] scaffold0193 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0193 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: scaffold0193
Description:
Target: scaffold0193; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 145
Target Start/End: Original strand, 23733 - 23862
Alignment:
| Q |
16 |
agagaagatatgaatatagtgaacaatggatcgtagtttaaagaatactagagatactctaaacctagtacaatctaatatttatttttgaaaaagggat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23733 |
agagaagatatgaatatagtgaacaatggatcatagtttaaagaaaactagagatactataaacctagtacaatctaatatttatttttgaaaaagggat |
23832 |
T |
 |
| Q |
116 |
cacattagtttattatatttttaaattgtt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23833 |
cacattagtttattatatttttaaattgtt |
23862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University