View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_high_27 (Length: 220)
Name: NF6086_high_27
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 1940123 - 1940312
Alignment:
| Q |
18 |
atatggaagcaatcaagaagttttggacaaagtgaggactttcaaagatggtaaaatcaaaatatcaaaggaaggtgaacttcttcataatgaagatgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1940123 |
atatggaagcaatcaagaagttttggacaaagtgaggactttcaaagatggtaaaatcaaaatatcaaaggaaggtgaacttcttcataatgaagatgga |
1940222 |
T |
 |
| Q |
118 |
acagcaatttcaggtgacattcgtaatagttgggctggtgtcacaactttgcagaccctttttgttctagaacacaatgctgtctgtgat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1940223 |
acagcaatttcaggtgacattcgtaatagttgggctggtgtcacaactttgcagaccctttttgttctagaacacaatgctgtgtgtgat |
1940312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 1954584 - 1954773
Alignment:
| Q |
18 |
atatggaagcaatcaagaagttttggacaaagtgaggactttcaaagatggtaaaatcaaaatatcaaaggaaggtgaacttcttcataatgaagatgga |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||| || | ||||||| | | || ||| ||| || |||||| ||||| |
|
|
| T |
1954584 |
atatggaagcaatcaagaagttttgaacaaagtgagaactttcaaagatgggaagttaaaaatattagacgatggtacccttaagcaaaatgaaaatgga |
1954683 |
T |
 |
| Q |
118 |
acagcaatttcaggtgacattcgtaatagttgggctggtgtcacaactttgcagaccctttttgttctagaacacaatgctgtctgtgat |
207 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||||||||| | || ||| ||| ||||||||||||| | |||||| |
|
|
| T |
1954684 |
gtagcaatttcaggtgacgttcgcaatagttgggctggtgtctcaactttgcaggctctctttattcaagaacacaatgctttttgtgat |
1954773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 1925793 - 1925985
Alignment:
| Q |
18 |
atatggaagcaatcaagaagttttggacaaagtgaggactttcaaagatggtaaaatcaaaatatcaaaggaagg---tgaacttcttcataatgaagat |
114 |
Q |
| |
|
||||||||||||| | ||| ||||| | |||||||||||| | ||||||| || | ||||||||||||||||| | | ||||| || || |||||| |
|
|
| T |
1925793 |
atatggaagcaatgatgaaattttgacccaagtgaggacttcccaagatgggaagttaaaaatatcaaaggaaggaaatcatcttctacaaaacgaagat |
1925892 |
T |
 |
| Q |
115 |
ggaacagcaatttcaggtgacattcgtaatagttgggctggtgtcacaactttgcagaccctttttgttctagaacacaatgctgtctgtgat |
207 |
Q |
| |
|
||| |||||||||||||| |||| ||||||||||||||||| |||||||||| ||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
1925893 |
ggagttgcaatttcaggtgatgttcgcaatagttgggctggtgtttcaactttgcaagcccttttcattcaagaacacaatgctgtttgtgat |
1925985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University