View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_high_7 (Length: 378)
Name: NF6086_high_7
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 372
Target Start/End: Complemental strand, 2392962 - 2392587
Alignment:
| Q |
1 |
gaaagtcacaccttaattattttaaccatttggtatattattttttgtcttttcttaagatatattattctagataaaataatattacataattttgtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2392962 |
gaaagtcacaccttaattattttaaccatttggtatattattttttgtcttttattaagatatattattctagataaaataatattacataattttgtct |
2392863 |
T |
|
| Q |
101 |
aaaatggccggcgctgtcggactatctgaactctgaagataagttttcgtttaaagatttaatagttctagttgcatgcaattacattgatgaaatgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2392862 |
aaaatggccggcgctgtcggactatctgaactctgaagataagttttcgtttaaagatttaatagttctagttgcatgcaattacattgatgaaatgatt |
2392763 |
T |
|
| Q |
201 |
tttataatttctcttatacattttttatttcccagctctgatataattcacgttttcttttgttgttgacaatctcattcatgtttttctttaggggaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2392762 |
tttataatttctcttatacattttttatttcccagctctgatataattcacgttttcttttgttgttgacaatctcattcatgtttttctttaggggaat |
2392663 |
T |
|
| Q |
301 |
ctcattcatgtttcttgac----ataaactagtgcaccgactattttgatgataaggtatcaccgttctgtgctgc |
372 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2392662 |
ctcattcatgtttcttgacatatataaactagtgcaccgactattttgatgataaggtatcaccgttctgtgctgc |
2392587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University