View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6086_low_18 (Length: 253)
Name: NF6086_low_18
Description: NF6086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6086_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 35174 - 34953
Alignment:
| Q |
19 |
tctctatctataataataataacaacatcaacattaatcaatttgaaggataaccgctcctcctcctcccccttggctagatggatctaagaaatagtcg |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35174 |
tctctatctataataataataacaacaacaacattaatcaatttgaaggataaccgctcctcctcctcccccttggctagatggatctaagaaatagtcg |
35075 |
T |
|
| Q |
119 |
acagcacgcatgcattgtttctctgcaaatgcatccaatccaatcaaatctacctttaattgtttatgtgattgggatcaaaacaaagatttcttctttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074 |
acagcacgcatgcattgtttctctgcaaatgcatcc-----aatcaaatctacctttaattgtttatgtgattgggatcaaaacaaagatttcttctttt |
34980 |
T |
|
| Q |
219 |
ctttttagacaagattattaattagaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34979 |
ctttttagacaagattattaattagaa |
34953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University